Manual para dummies ¿por qué el test PCR no sirve en absoluto para detectar el Covid?

entcons

Madmaxista
Registrado
6 Ene 2010
Mensajes
1.318
Puntuación de reacción
3.330
Vamos a culturizar un poco al personal. Trataré de simplificar al máximo.

El test PCR funciona de la siguiente manera:

1) tienes una serie de secuencias de oligonucleótidos que puedes comprar en el mercado y en teoría son específicas del 2019-Covid.
Éstas curiosamente cambian dependiendo del país, o sea cada país impone sus secuencias oficiales para detectar 2019-Covid.
Lo que tienen en común para todos los países es que lógicamente esas las secuencias deben existir en el genoma aislado del 2019-Covid .

2) Veamos aquí cuáles son la secuencias oficiales para detectar 2019-Covid en Europa:

1586945951282.png


Research Use Only 2019-Novel Coronavirus (2019-nCoV) Real-time RT-PCR Primer and Probe Information

3) Esas secuencias son lo que se llaman "primer forwards" ,"primer reverse" y "probe". Volveremos a esto más adelante.

4) Al realizar la prueba, se coge una muestra de la traquea de la persona y se mete en un tubo de ensayo. En esa
muestra se encuentra multitud de DNA de organismos.

5) Se procede a calentarlo a 90 grados para que el DNA se divida en dos cadenas

6) El "forward primer" comprado en el mercado se junta automáticamente al inicio de la cadena, y el "primer reverse"
al final de la cadena
, pero eso sólo ocurre sí y sólo sí el DNA de la muestra es el del 2019-Covid, en caso contrario los pares no se acoplarían. El acoplado de cada par de cada secuencia es binario, es decir cada para sólo puede acoplarse a su complementario.

1586946490100.png


7) En el proceso se acopla también el "Probe" en mitad de la cadena, con una molécula de fosforecencia.

8) Se inicia el proceso del polimerización en tiempo real, por el que la encima polimerase empieza a rellenar los huecos existentes generando nuevo DNA sintético (en verde en gráfico de arriba), hasta que la cadena original de muestra del paciente queda totalmente acoplada con su otra contraparte (compuesta del forward primer, reverse primer, y nuevo DNA proviniente de la polimerización).

9) Así conseguimos un DNA perfecto de 2 cadenas y la liberación de la molécula fosforecente.

10) Se repite el proceso hasta en 40 ciclos (que incluyen calentamiento y enfriamento) que van generando más y más fosforecencia en cuanto más y más sea la cantidad de coincidencias entre los "primers" "forwards" y "probes" (en teoría específicos del 2019-Covid) con el ADN de la muestra del paciente. Eso significará teóricamente que a más intensidad de fosforecencia, para un máximo 40-45 ciclos, más carga viral de Covid debería tener el paciente.

1586946971713.png


Aquí se explica más detallademente el proceso entero:
How COVID-19 is diagnosed: bacterium assisted DNA searching - Articles


¿Cuáles son los problemas del test PCR para detectar el Covid?

1- No hay un estándard mundial y cada país usa las secuencias que desea.
2- A mayor nivel de ciclos de temperatura, más positivos, dado que hay más probabilidad ruido y contaminación, por lo que menos fiabilidad.
3- Y en mi opinión el más grave: la polimerización rellena todos los huecos que dejan los primers y probes. Eso quiere decir que si los primers y probes no encajan al 100% en todos sus pares con la cadena de la muestra, la polimerización rellenará esos huecos y, a base de ciclos, dará falsos positivos.


Pero... ¿es que los primers y probes no son específicos del 2019-nCovid? Es como si pregunto si 4 frases al azar sólo pueden existir en un libro. Pues no, pueden aparecer estadísticamente en cualquier otro en una biblioteca de trillones de libros (orden de magnitud del genoma de un virus).

Vosotros mismos podéis comprobar esas secuencias oficiales del 2019-Covid en la base de datos BLAST para el genoma humano:
1586947567800.png

1586947606991.png


Probad de hacer vosotros la misma búsqueda en BLAST para las otras secuencias en teoría específicas del 2019-Covid:

TCTGGTTACTGCCAGTTGAATCTG

GGGAGCCTTGAATACACCAAAA

y os daréis cuenta que aparecen todas en el genoma del Homo Sapiens con porcentajes de coincidencia del 70 al 90%.

¿Qué quiero decir con todo esto?

1) Que el test PCR para detectar el 2019-Covid puede dar los falsos positivos que queramos simplemente aumentando el número
de ciclos o comprando en el marketplace los primers (gran negocio para los laboratorios vendiendo cosas que nadie mira con microscopio electrónico) que nos dé la gana como hace cada país

2) Que cuando das positivo, lo único que quiere decir con 100% de probabilidad es que eres un Homo Sapiens. No es posible discernir el positivo Homo Sapiens del positivo 2019-Covid. Si das negativo es porque entras dentro del ruido estadístico
"More dye molecules are released with each PCR cycle. This leads to an increase in the fluorescence signal proportional to the amount of amplicon synthesized. "

3) Los propios test PCR directamente comprados en China pueden estar infectados con 2019-Covid. Así que vigilad qué os meten en la boca para extraer la muestra.


Cada país fija su procedimiento para el test PCR seleccionando primers y probes, procedimiento extracción , conservación, número de ciclos. Así pues un país podría fijar un número de ciclos fijo que acabará fijando siempre el mismo porcentaje de positivos y negativos simplemente por ruido estadístico (por ejemplo, cada 100 testeados sale siempre 10 positivos).

Pues resulta que en el Coronavirus Update (Live): 2,014,554 Cases and 127,598 Deaths from COVID-19 Virus Pandemic - Worldometer no te dicen la cifra de testeados, sólo la cifra de positivos (activos y cerrados). ¿Sabéis por qué? Para que no se vea que siempre es el mismo porcentaje de positivos respecto testeados para cada país! Cosa que indicaría que el test no sirve para nada ya que los resultados se fijan de antemano con el procedimiento. El número de positivos simplemente depende de: cantidad de testeados, procedimiento de cada país.
 

Adjuntos

Última edición:

Profesor Bacterio

Madmaxista
Registrado
31 Dic 2014
Mensajes
7.233
Puntuación de reacción
19.961
Ubicación
Rue du percebe, 13
El propio inventor de los tests de PCR, premio nobel de química en 1993, fallecido el año pasado, dijo claramente que estos tests no servían para identificar este tipo de virus por su baja especifidad. El problema no es la sensibilidad, es la especificidad.

De los tests rápidos mejor ni hablar, no hay ninguno homologado y que haya demostrado ser fiable. Si se los haces a una misma persona igual ahora da positivo, dentro de 6 horas da negativo o dudoso, mañana por la mañana se lo vuelves a hacer y vuelve a dar positivo o dudoso, y mañana por la tarde vuelve a dar negativo. Es una ruleta rusa.

Y lo mejor de todo es que dan el nº de casos diarios con total precisión, p.ej hoy ha habido 573 muertos y 3564 contagios, como cojones cuentas una cosa que no se puede medir y los síntomas son inesepecífos variando además enormemente de unos individuos a otros.

Señores, están contando humo. Dejen ya de engañar a la gente.
 

entcons

Madmaxista
Registrado
6 Ene 2010
Mensajes
1.318
Puntuación de reacción
3.330
El propio inventor de los tests de PCR, premio nobel de química en 1993, fallecido el año pasado, dijo claramente que estos tests no servían para identificar este tipo de virus por su baja especifidad. El problema no es la sensibilidad, es la especificidad.

De los tests rápidos mejor ni hablar, no hay ninguno homologado y que haya demostrado ser fiable. Si se los haces a una misma persona igual ahora da positivo, dentro de 6 horas da negativo o dudoso, mañana por la mañana se lo vuelves a hacer y vuelve a dar positivo o dudoso, y mañana por la tarde vuelve a dar negativo. Es una ruleta rusa.

Y lo mejor de todo es que dan el nº de casos diarios con total precisión, p.ej hoy ha habido 573 muertos y 3564 contagios, como cojones cuentas una cosa que no se puede medir y los síntomas son inesepecífos variando además enormemente de unos individuos a otros.

Señores, están contando humo. Dejen ya de engañar a la gente.
aparte de no servir para nada, esos tests PCR son un negocio brutal para los laboratorios.
Cada test en USA vale 230$ para 1000 reacciones (25 personas a ciclos de 40). O sea 3700 millones de dólares en una población como la de USA...
 

Profesor Bacterio

Madmaxista
Registrado
31 Dic 2014
Mensajes
7.233
Puntuación de reacción
19.961
Ubicación
Rue du percebe, 13
aparte de no servir para nada, esos tests PCR son un negocio brutal para los laboratorios.
Cada test en USA vale 230$ para 1000 reacciones (25 personas a ciclos de 40). O sea 3700 millones de dólares en una población como la de USA...

No es que no sirvan, si que sirven, pero no para este tipo de virus ya que el test de amplificación con PCR tampoco puede distinguir el covid-19 de otros coronavirus, y recuerden que un porcentaje nada despreciable de resfriados (se habla de entorno al 20%) están causados por virus de la familai del coronavirus.


Es todo un despropósito.
 

Profesor Bacterio

Madmaxista
Registrado
31 Dic 2014
Mensajes
7.233
Puntuación de reacción
19.961
Ubicación
Rue du percebe, 13
Gran hilo. Yo ya llevo comentando desde hace tiempo que lo que miden los tests son secuencias endógenas a la mayoría de seres humanos. De ahí el 80% de falsos positivos.

Manifiesto CoV-R78

Esto no lo oiras en las fake news estatalistas.

Tratan de promover el caos y la anarquía con una cosa que no se puede medir por ahora ni se puede diagnosticar en base a la sintomatología porque esta es inespecífica y varían enormemente (de manera tan sospechosamente exagerada que ha lllevado a mucha gente a creer que incluso es un fake) de unas personas a otras
 

Lonchix

Madmaxista
Registrado
26 May 2018
Mensajes
18.169
Puntuación de reacción
37.144
Ubicación
Kandahar

Lonchix

Madmaxista
Registrado
26 May 2018
Mensajes
18.169
Puntuación de reacción
37.144
Ubicación
Kandahar
Si os fijáis para demostrar la especificidad del test PCR, la WHO compara las secuencias con las de otros virus,
resultando negativo. Pero ¿por qué no las compara también contra el genoma humano?
Brutal... Escandaloso. Que manipulación!
 
Última edición:

SargentoHighway

Madmaxista
Registrado
3 Ene 2011
Mensajes
687
Puntuación de reacción
1.144
Estáis diciendo que los tests tienen un % de positivos de antemano. Es decir, cojo a 100 persona sanas y obtendré que un % de ellas son positivo. Y si cojo a 100 personas enfermas exactamente ese mismo % que obtuve con las sanas me sale en este caso.

y por que en países que hacen muchos más tests que españa tienen menos infectados?? eso desmonta la teoría de lo que acabo de decir no??