La Estafa Ha Sido Confirmada: La PCR No Detecta El SARS-CoV-2, Sino Secuencias De Genes Endógenos

hijodeputin

Madmaxista
Registrado
7 Abr 2008
Mensajes
11.850
Puntuación de reacción
18.849
Por cierto, os pasa a los que tengais twitter o facebook que intenteis postear algo que incluya el enlace de la primera página y os diga que algo salió mal???. A mi no me deja.
 

ueee3

Madmaxista
Registrado
11 Jun 2019
Mensajes
16.666
Puntuación de reacción
16.323
La Estafa Ha Sido Confirmada: La PCR No Detecta El SARS-CoV-2, Sino Secuencias De Genes Endógenos - Médicos Por La Verdad España

"Las secuencias genéticas utilizadas en las PCR para detectar sospechas de SARS-CoV-2 y diagnosticar casos de enfermedad y muerte atribuidos a Covid-19 están presentes en decenas de secuencias del propio genoma humano y en las de un centenar de microbios . Y eso incluye los iniciadores o cebadores, los fragmentos más extensos tomados al azar de su supuesto “genoma” e incluso los llamados “genes diana” supuestamente específicos del “nuevo coronavirus”.

La prueba no tiene valor y todos los resultados “positivos” obtenidos hasta ahora deben ser científicamente invalidados y comunicados a los afectados; y si han fallecido, a sus familiares. Stephen Bustin, uno de los principales expertos mundiales en PCR, de hecho dice que bajo ciertas condiciones, ¡cualquiera puede dar positivo! Les hemos estado advirtiendo desde marzo: no puede realizarse pruebas específicas para un virus sin conocer los componentes del virus que está tratando de detectar. Y los componentes no se pueden conocer sin haber aislado/purificado ese virus.

Desde entonces seguimos acumulando evidencia de que nadie ha aislado el SARS-CoV-2 y, lo que es más importante, que nunca se podrá aislar por las razones que explicamos el mes pasado (lea el informe “¿Se puede probar que existen virus patógenos?” en nuestro sitio web www.dsalud.com). Y en el presente informe vamos a ofrecer nuevos datos que demuestran que la RT-PCR no detecta el llamado SARS-CoV-2 como se le conoce, sino fragmentos de ARN humano y los de numerosos microbios."

The scam has been confirmed: PCR does not detect SARS-CoV-2, but endogenous gene sequences
¿Pero todo esto no se dijo hace ya MESES? ¿O ahora lo han probado mejor?
 

miki

Madmaxista
Registrado
3 Nov 2011
Mensajes
726
Puntuación de reacción
1.671
La Estafa Ha Sido Confirmada: La PCR No Detecta El SARS-CoV-2, Sino Secuencias De Genes Endógenos - Médicos Por La Verdad España

"Las secuencias genéticas utilizadas en las PCR para detectar sospechas de SARS-CoV-2 y diagnosticar casos de enfermedad y muerte atribuidos a Covid-19 están presentes en decenas de secuencias del propio genoma humano y en las de un centenar de microbios . Y eso incluye los iniciadores o cebadores, los fragmentos más extensos tomados al azar de su supuesto “genoma” e incluso los llamados “genes diana” supuestamente específicos del “nuevo coronavirus”.

La prueba no tiene valor y todos los resultados “positivos” obtenidos hasta ahora deben ser científicamente invalidados y comunicados a los afectados; y si han fallecido, a sus familiares. Stephen Bustin, uno de los principales expertos mundiales en PCR, de hecho dice que bajo ciertas condiciones, ¡cualquiera puede dar positivo! Les hemos estado advirtiendo desde marzo: no puede realizarse pruebas específicas para un virus sin conocer los componentes del virus que está tratando de detectar. Y los componentes no se pueden conocer sin haber aislado/purificado ese virus.

Desde entonces seguimos acumulando evidencia de que nadie ha aislado el SARS-CoV-2 y, lo que es más importante, que nunca se podrá aislar por las razones que explicamos el mes pasado (lea el informe “¿Se puede probar que existen virus patógenos?” en nuestro sitio web www.dsalud.com). Y en el presente informe vamos a ofrecer nuevos datos que demuestran que la RT-PCR no detecta el llamado SARS-CoV-2 como se le conoce, sino fragmentos de ARN humano y los de numerosos microbios."

The scam has been confirmed: PCR does not detect SARS-CoV-2, but endogenous gene sequences
Ok.

Que no se pueden detectar virus.

Que lo que se detecta es ARN humano.

O ARN de microbios (bacterias? Solo tienen ARN, igual que los humanos.)

Los cebadores se cogen de su genoma. Claro que sí.

Vaya COJONAZOS que tenéis. Es difícil condensar más gilipolleces en tan poco texto. Disfruta de tu vacuna, subdotao.
 

Farmafia

Expectro en Prohivirus
Registrado
16 Ene 2019
Mensajes
4.816
Puntuación de reacción
8.434
Cebadores universales. Para la niña y el niño. Para secuenciar a toda la familia. Las mascotas también. Y siempre está de buen humor, siempre positivo. Nunca negatifo.
 

EYE

Himbersor
Registrado
8 May 2017
Mensajes
327
Puntuación de reacción
938
Por cierto, os pasa a los que tengais twitter o facebook que intenteis postear algo que incluya el enlace de la primera página y os diga que algo salió mal???. A mi no me deja.
Normal que no te deje. Twitter no permite FAKE NEWS que confundan a la población.
Prueba en Parler.
 
Última edición:

meodepie

Himbersor
Registrado
15 Mar 2020
Mensajes
1.212
Puntuación de reacción
2.455
Ubicación
A tomar por c.
Hay una cosa muy clara y es lo siguiente: al demostrarse la falacia de los test PCR, ABSOLUTAMENTE TODO lo que viene detrás se desmonta por sí mismo y carece totalmente de sentido. TODO.
 

EYE

Himbersor
Registrado
8 May 2017
Mensajes
327
Puntuación de reacción
938
Hay una cosa muy clara y es lo siguiente: al demostrarse la falacia de los test PCR, ABSOLUTAMENTE TODO lo que viene detrás se desmonta por sí mismo y carece totalmente de sentido. TODO.
Tu información basura no demuestra nada.
Bueno si, demuestra que eres un fanático conspiranoico que intenta confundir a la población para remar en sentido contrario.
 

fayser

Será en Octubre
Registrado
7 Feb 2008
Mensajes
20.989
Puntuación de reacción
51.108
Una refutación de mierda al estilo Newtral.

El artículo original toma de los estudios las secuencias genéticas atribuidas al virus y las busca en una base de datos, por ejemplo ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG, encontrando múltiples coincidencias.

Ahora los de Newtral dicen: "un experto ha dicho que la PCR sí detecta trozos de genoma únicos del virus".

Y cuando esperas que te digan "por ejemplo, este trozo es único del virus: ACTACGACAGATGTTGTGCCGGTA", resulta que no dicen NADA.

Es decir, una refutación por los cojones morenos de un ejperto. Como siempre.
 

Gravityless

Y..¿después del resplandor?
Registrado
15 Nov 2020
Mensajes
230
Puntuación de reacción
302
Por si este producto artificial no era suficiente, se publica en el año 2008 un artículo de la Academia China de Ciencia Médica en el que detallan un método para producir ARN viral y citan por primera vez a los virus quimera SARS CoV 1, 2 y 3 (4), lo cual demuestra sin lugar a dudas primero que no es un virus natural y segundo que no es un virus nuevo."
Que me estas diciendo! que nos queda el SARS CoV 3 y 4??? nos pueden pasar el tráiler?
yo me bajo del mundo ya. Ni un confinamiento más.
 

A.Daimiel

0FE5AP5ARE
Registrado
1 Abr 2019
Mensajes
1.329
Puntuación de reacción
3.739
hay que hacer caso a lo que diga newtrola, esos grandísimos hijos de perra que tienen todas las redes sociales censuradas con su comunismo
 

EYE

Himbersor
Registrado
8 May 2017
Mensajes
327
Puntuación de reacción
938
  Es duro pedir pero más duro es robar
Por favor, permite que se muestren anuncios en burbuja.info y contribuirás a su supervivencia.