El "VIH/SIDA" es una "SÍFILIS II" o "Sífilis, Segunda Parte" (Autopsia de un viejo FRAUDE MÉDICO, la


Será en Octubre
14 May 2010
Puntuación de reacción
Presento uno de mis hilos más raros: Un montón de referencias y citas de viejos libros y revistas, y todo sobre un tema del cual ya apenas se habla: La Sífilis.

* La Sífilis (a mi juicio y al de muchos otros que les voy a presentar en este hilo) era un Fraude. Fraude en el (altamente dudoso) "diagnóstico serológico", o bien Fraude en su fase terciaria (consecuencia del "tratamiento", según un miembro de la Academia de Ciencias USA) o bien fraude completo incluso en su misma etiología.

* El "VIH/SIDA" (a mi juicio) es EL MISMO fraude de la Sífilis pero "reempaquetado". Por eso lo llamo "Sifilis II".


TimoÉbola = TimoSIDA Reloaded

TimoSIDA = TimoSífilis Reloaded.

Ergo TimoÉbola = TimoSífilis Re Re Loaded

El TimoSífilis es la Madre de todos los Timos de "enfermedades" INESPECÍFICAS con 1001 síntomas y "diagnóstico" a base de "test de anticuerpos".​

Si saben ustedes inglés les aconsejo que lean este excelente libro "Disidente de la Sífilis" de 1962:

Todo lo que les voy a presentar en este hilo son pruebas adicionales a lo que les narra este libro del Naturópata Herbert Shelton. El Dr. Shelton presenta un impresionante aparato de citas desmontando la "Sifilografía" (así se llamaba la "Ciencia de la Sífilis") Oficial de su tiempo.

¿Por qué diablos ha de interesarles este asunto si hoy casi nadie recuerda la Sífilis?:

* Porque PUEDE SALVAR SU VIDA que aprendan ustedes a dudar de lo que les diga el médico de turno. La increíble colección de incongruencias y disparates lógicos y científicos que les voy a presentar en este hilo era DOGMA MÉDICO hace 60-100 años. Muchos pacientes MURIERON O ENFERMARON por no haber buscado y evaluado críticamente la información que aquí les presento.

* Porque es Historia de la Medicina y de la Sociedad, y quien no conoce la Historia está condenado a repetirla.

* Porque el "VIH/SIDA" es una "Sifilis II", una "reedición" del TimoSífilis. Entender el TimoSífilis supone entender mejor el TimoSIDA.

* Porque creo que es psicológicamente más accesible intentar que la persona media cuestione un fraude médico de hace 100 años (EL TimoSífilis) que uno actual (el TimoSIDA). Una vez que alguien consiga ver el TimoSífilis, es más fácil que vea el TimoSIDA. El TimoSïfilis sería un "peldaño de entrada" más aacesible psicológicamente para poder asumir la enormidad de los fraudes médicos actuales.

* Porque (me temo) los Disidentes del SIDA dentro de 100 años seremos una minúscula nota a pie de página, como los son actualmente los Disidentes de la Sífilis que voy a presentarles (Herbert Sheldon y Dr. Vander)​

Empiezo desmintiendo toda la Sifilografía con los mismísimos Postulados de Koch y 2 referencias oficialistas:

because...the limitations of direct microscopy, serologic testing is the mainstay of laboratory diagnosis

Syphilis: Review with Emphasis on Clinical, Epidemiologic, and Some Biologic Features

El supuesto agente causal de la sífilis NO APARECE en la mayor parte de los "infectados". Violación directa del Primer Postulado de Koch.

Although many investigators have claimed to
have cultivated it in vitro, none of the isolated
strains have been pathogenic or have been
shown to have a causal relationship to treponemal disease in humans


Violación del Cuarto Postulado de Koch.

Les resumo (luego iré añadiendo citas respaldando todas mis afirmaciones) todos los paralelismos TimoSífilis-TimoSIDA:

Los "infectados por la sífilis" muy frecuentemente no tenían "antígeno" (Treponema Pallidum, la causa oficial de la sífilis) presente.

Ídem para los "infectados por el VIH".​

Como el maldíto antígeno supuestamente causante de la sífilis no aparecía se preferían los "tests de anticuerpos" ("serología") para saber quién estaba "infectado".

Ídem para los infectados por el VIH". Los "tests de VIH" que determinan si alguien está o no "infectado" son de anticuerpos, no de antígeno.​

Los "tests de anticuerpos" para la Sífilis eran (sorpresa, sorpresa) altamente inespecíficos y con todo tipo de excusas y evasivas si uno se molestaba en leer la literatura técnica.

Ídem para los "tests de VIH".​

La Sífilis era "El Gran Enmascarador", ya que (se decía oficialmente) podía "disfrazarse" de muchas enfermedades diferentes, totalmente imposibles de diagnosticar como sífilis sin "test de anticuerpos".

Ídem para la "enfermedad por VIH": 30 enfermedades que también se dan en "VIH-". El SIDA no tiene entidad clínica propia desde el cambio de definición de 1987 (antes de 1987 SIDA era KS y/o PCP en personas sin causa de inmunosupresión).​

Había campañas de histeria pública invitando a "testarse" de la sífilis a todo el mundo.

Ídem con el "VIH".​

La sífilis -oficialmente- se transmitía primordialmente por vía sexual, transfusiones y madre-hijo.

Ídem con el "VIH".​

No obstante, a veces aparecía "infección sifilítica" en hijos de no sifilítica vírgenes... entonces se alegaba la "infección inocente" de la sífilis, vía -supuestamente- lesiones cutáneas.

Ídem con la "infección inmaculada" de "VIH" (gente que es "VIH+" pese a ser virgen, no haber consumido drogas y ser su madre "VIH-")​

El Treponema Pallidum oficialmente puede permanecer "latente" durante años, y -por causas desconocidas- "reactivarse" y causar enfermedades.

Ídem con el "VIH", que aún nadie nos ha explicado por qué misterioso motivo se pasa 5, 10 o 20 años sin causar enfermedades. ¿Qué hace en esos años?. ¿Está de vacaciones?.​

El "tratamiento" de la sífilis era altamente tóxico tenía efectos secundarios indistinguibles de la misma sífilis.

Compuestos de Mercurio inyectados intravenosamente (¡¡¡!!!). Como dijo Peter Duesberg sobre el AZT: "Con tratamientos como estos, ¿quien necesita enfermedades?".

Incidentalmente el mercurio es Neurotóxico. Según Duesberg (miembro de la Academia de Ciencias USA) la "Sífilis terciaria" estaba producida por el "tratamiento".

La "bala mágica" de Ehrlich (El ARSENICAL Salvarsán o "606") tenía el "inconveniente" de matar a los pacientes de vez en cuando, como explican en este texto de la época.

Les adelanto que estos productos ALTAMENTE TÓXICOS se administraban a personas simplemente por dar positivo en un test que la misma literatura médica (ver más abajo) reconocía que NO TENÍA NADA QUE VER con el supuesto agente causal de la Sífilis.

Like today’s chemotherapy drugs for cancer, Salvarsan didn’t come without risks. Made from 32 percent arsenic, the drug could cause severe tissue damage and even death if not injected directly into a vein. Although Ehrlich warned the medical community about the chemical’s toxicity, critics accused him of marketing a dangerous drug and getting rich off the proceeds.

Aug. 31, 1909: First Chemotherapy Drug Treats Syphilis | This Day In Tech | Wired.com

Ídem con el AZT, nuestro "Salvarsán" moderno para el "VIH":

Duesberg on AIDS- AZT Articles

Increíblemente TODOS los "tratamientos anti VIH" nos explican en sus prospectos que sus "efectos secundarios" son indinstinguibles de los (supuestos) efectos del "VIH" (igual que el mercurio causaba síntomas neurológicos indistinguibles de la "sífilis terciaria)

CUATRO: Los "fármacos anti VIH" que producen LOS MISMOS efectos que el "VIH" (supuestamente) produce

Texto que aparece en el Vademecum MEDICOM 1999 (página 565) del prospecto del Combivir, un "tratamiento" para la "infección por VIH" compuesto de Lamivudina y Zidovudina (AZT).

Traduzco: El laboratorio que fabrica el "fármaco" confiesa que no puede diferenciar sus efectos secundarios de los (supuestos) efectos de la "infección por VIH".

O dicho en román paladino: El "fármaco" produce los mismos efectos que la enfermedad que pretende tratar.

En este prospecto se nos informa también de las reacciones adversas de la Zidovudina (AZT), y se nos dice que que una de ellas es "Leucopenia".

Leucopenia significa disminución de los Glóbulos Blancos.

Los Glóbulos Blancos son los "soldados" del Sistema Inmune, ergo la Zidovudina es un... Inmunosupresor.

Están "tratando" una Inmunodeficiencia como es el SIDA...con un Inmunosupresor.

Como dice Peter Duesberg: "El AZT es SIDA embotellado, SIDA por prescripción médica" y "Con tratamientos como estos, ¿quién necesita enfermedades?".

Aquí otro prospecto de "fármacos anti VIH" con la misma coletilla:

...y otro más...

...y otro...

...y otro...

Aquí nos explican que la "infección por VIH" produce Mielosupresión (disminución de la función de la médula ósea)... y el "tratamiento de la infección por VIH"....TAMBIÉN.

Muchos pacientes tratados con Caelyx presentan mielosupresión basal debida a factores tales como su enfermedad VIH preexistente o numerosos tratamientos concomitantes o previos, o tumores que afecten la médula ósea...

...A diferencia de la experiencia en pacientes con cáncer de mama o de ovario, en pacientes con SK-SIDA el acontecimiento adverso limitante de dosis parece ser la mielosupresión (ver sección 4.8). Debido a su potencial de supresión de la médula ósea, se deberán llevar a cabo recuentos sanguíneos periódicos frecuentemente durante el transcurso del tratamiento con Caelyx y como mínimo, antes de cada dosis de Caelyx.

Ensayos clínicos en pacientes con SK-SIDA tratados con 20 mg/m2 de Caelyx muestran que la mielosupresión fue la reacción adversa más frecuente que se consideró relacionada con Caelyx, apareciendo muy frecuentemente (en aproximadamente la mitad de los pacientes).
La leucopenia es la reacción adversa más frecuente experimentada con Caelyx en esta población; también se han observado neutropenia, anemia y trombocitopenia.


Observen las etiquetas de productos con Arsénico:

O con Mercurio:

¿Ven el "tema" común de la Sífilis con el "VIH/SIDA"?: Tratamientos VENENOSOS (con calavera en la etiqueta) para "tests serológicos" altamente dudosos.

O como resumío John Lauritsen el TimoSIDA:

Phoney diagnosis followed by lethal treatment.

Diagnóstico falso seguido de tratamiento letal

Citas de libros de Medicina antiguos en Español:


Dr. Ludolfo Krehl. Profesor de Heidelberg.

Tratado de Fisiología patológica.

Editorial Labor. Barcelona. 1923

Lean por favor esta cita porque es para salirse las órbitas de los ojos:

Página 41

Cimentada la teoría de la fijación del complemento nació la célebre reacción de WASERMANN, de resultados prácticos tan fecundos. Mezclando lo que al principio se creía antígeno sifilítico (extracto de hígado de heredosifilítico) con los anticuerpos (del suero del enfermo),...Con un estudio más detenido de esta reacción en la sífilis se ha demostrado el hecho sorprendente de que no precisa el extracto de un órgano luético [CON SÍFILIS] y basta el extracto alcohólico de un órgano normal. La desviación del complemento se produce no sólo por la mezcla de antígeno y anticuerpos sifilíticos, sino también con extractos normales y suero sifilítico. Ni siquiera es indispensable la sangre de un sifilítico. Según las observaciones de U. FRIEDMANN (3), parece depender más bien de las proporciones respectivas de cuerpos albuminoides del plasma que un suero inactive la alexina en la reacción de WASSERMANN. Es notorio que esa proporción es muy elevada en un suero sifilítico, aunque no de manera constante...

Estupendo: El idolatrado test de WASSERMANN NO ES ESPECÍFICO a la sífilis, lo cual no obsta para que el bueno de Krehl nos diga a continuación:

....Esto no es obstáculo para poder afirmar que la reacción irreprochablemente practicada y prudentemente interpretada tiene una importancia práctica inmensa. Pero, en cambio, la interpretación teórica de la reacción no hace más que vislumbrarse.

Ah, fantástico: En Teoría aún están "vislumbrando" qué demonios es la reacción de Wassermann, pero su "importancia práctica" -nos dice- es "inmensa".

TRADUCIDO A LENGUAJE DE LA CALLE: "No tengo N.P.I. de qué significa realmente un test de Wassermann en teoría, pero me es muy práctico para hacer lo que me da la gana".

Que un autor diga que NO SABE qué significa un test pero que es muy "práctico" es una BANDERA ROJA DE MAGUFERÍO.

Esto es de 1923. Ya sabían en 1923 que el "test de Wassermann" ERA INESPECÍFICO, lo cual no les impidió usarlo durante 40 años más.


Microbiología Médica.

Dr. Emilio Zapatero Ballesteros. Catedrático de la Facultad de medicina de Valladolid.

Aldus. Santander. 1962.

Depósito legal SA.63-1958

Primera cita:

Nunca se ha observado el período terciario en animales, el que en el hombre está constituido por lesiones del sistema nervioso o viscerales.

Según Peter Duesberg la "Sífilis Terciaria" era consecuencia del "tratamiento" para la sífilis.

El "éxito" del "tratamiento" de la sífilis con Penicilina fue que la Penicilina SUSTITUYÓ al "tratamiento" anterior con Arsenicales tóxicos (Salvarsán), lo mismo que el "éxito" del Salvarsán fue que asu vez sustituyó al más tóxico aún "tratamiento" con Mercuriales.

La sífilis experimental del conejo tiene el inconveniente, a la hora de buscar el espiroquete en las lesiones, de que este animal puede padecer la presencia de un espiroquete especial, morfológicamente análogo al de la sífilis, que es el Tr. Cuniculi; pero la transmisión en serie y el aspecto típico de las lesiones sifilíticas resuelven la posible confusión

ALERTA ROJA DE MAGUFERÍO: Nos cuenta el buen señor oficialista de 1962 que hay un Treponema IDÉNTICO al que -se supone- causa la sífilis... pero que no es el que causa la sífilis.

¿Y cómo sabemos si el Treponema de la sífilis o no?: Pues porque el Treponema "correcto" causa lesiones sifilíticas, y el otro no...

...así que la presencia de "Treponemas" NO es específica de la Sífilis.

Este buen señor se ha cargado toda la ortodoxia de la Sifilografía en este párrafo.

El "VIH" también tiene sus partículas idénticas al "VIH", pero que no lo son:


La enfermedad se adquiere casi siempre por contacto sexual, pero también se producen las infecciones llamadas inocentes, ya que se puede dar la penetración del parásito a través de la piel o las mucosas escoriadas por contacto con el material infectante. Una forma muy importante de la sífilis inocente es la congénita...

"Transmisión vertical" e "infección inmaculada". Como con el "VIH".

La sífilis es una enfermedad esencialmente crónica, que puede producir la muerte sólamente al cabo de un período de tiempo largo, puesto que se mide por años...

Como el "VIH" (aunque en 1984 se nos decía que el "virus del SIDA" mataba en 10.5 meses.

Diagnóstico microscópico:

El examen microscópico del exudado...con condensador de fondo oscuro, resuelve muchas veces el problema diagnóstico y especialmente en el caso de la lesión primaria; el examen microscópico en fresco y condensador de fondo oscuro, del exudado del chacro sifilítico pone en claro habitualmente la naturaleza de la exudación

De los subrayados se deduce que EL TREPONEMA NO ESTÁ en todas las "lesiones sifilíticas", exactamente como el "VIH" está olímpicamente ausente en el 70-80% de los 2infectados":


El que el treponema sí esté tampoco debería probar nada, ya que reconocen que hay Treponemas "inocuos" (ver cita Noguchi 1913 más abajo) morfológicamente indistinguibles de los "Treponemas patógenos"..

Diagnóstico serológico

Como el del "VIH". Como el "antígeno" no está recurrimos a la "serología".

El antígeno consiste en un extracto de corazón de vaca [¡¡¡!!!]

Ah: Estupendo. El "antígeno" en una reacción serológica supuestamente específica para un test de reacción serológica al "Treponema Pallidum" es...¡extracto de corazón de vaca!. fantástico. ¡Especificidad garantizada!.

A pesar de los buenos servicios que estas reacciones serológicas prestan conviene repetir las positivas en ausencia de síntomas [¡¡¡!!!]

Ah, estupendo. Les traduzco a lenguaje de la calle: "El test es superfiable de la muerte, pero si el paciente no tiene síntomas tampoco se lo tomen muy en serio".

Es excepcional obtener un WASSERMANN + o más fuerte o un KAHN ++ o más intenso en ausencia de sífilis. Pueden en cambio obtenerse reacciones dudosas (W+- o K+) en algunos casos en que seguramente no se trata de sífilis. En estos casos las reacciones deben repetirse [WTF?]

Unos tests de los más fiable, ¿Verdad? [IRONÍA] Pueden dar "+" en no "infectados" y "-" en infectados. Los prospectos de los "tests de VIH" cuentan con advertencias idénticas en sus prospectos.

Yo me río... pero en los años 1960 el resultado de estos tests era un asunto VITAL para los pobres "usuarios de la salud" que se enfrentaban a un resultado "+" sin poder tener un atisbo de este libro para médicos que les estoy comentando. Hace 50 años no había Internet y el Médico era Dios. Entonces no había defensa intelectual alguna contra esta Magufada Institucionalizada que eran los "tests de Sífilis".

...así como las reacciones positivas tienen un valor diagnóstico positivo...

Y nos dice esto después de lo dicho arriba. Contradicción total.

...no ocurre lo mismo con las reacciones negativas, las que pueden dar en este caso determinados casos de sífilis

Los Negativos no son fiables. Los Positivos sí. ¡Pero si más arriba nos han dicho que no son fiables ni los positivos ni los negativos!.

En estos últimos años, el diagnóstico serológico de la sífilis se ha enriquecido con una serie de reacciones realizadas utilizando como antígeno el propio Treponema Pallidum

¡¡¡Extraordinario!!!, ¡¡¡era una INNOVACIÓN en 1962 usar al propio Treponema Pallidum como antígeno en el "test serológico"!!!.

Dado que el test de Wassermann es de 1906 resulta que los "Sifilógrafos" oficialistas se pasaron MEDIO SIGLO HACIENDO "TESTS DE SÍFILIS" SIN USAR PARA NADA EL ANTÍGENO contra el cual supuestamente estaban testando.


Wilson G. Smillie

A.B., M.D., D.P.H., SC. D. (hon.)

Catedrático de Sanidad Pública y Medicina Preventiva Cornell University Medical College

New York N.Y.




Página 329:

El diagnóstico de la sífilis no es un asunto sencillo. las manifestaciones clínicas de la enfermedad son tan diferentes que aun el clínico más experto fracasa a veces en el reconocimiento de la enfermedad... la enfermedad es muy difícil de reconocer en sus primeras fases. la sífilis puede existir durante años enteros sin amnifestación de ningún síntoma o con síntomas de tan poca importancia que el paciente se encuentra completamente inconsciente de que padece la enfermedad. Casi nunca nos es dado ver un caso clínico de sífilis en el que exista un historial de una lesión primaria característica seguida de las típicas manifestaciones secundarias...

El autor dice cándidamente que "casi nunca" se ve...lo que se describe como "típico" de la sífilis. Extrañísima "ciencia" la sifilografía que sus lesiones "típicas"...casi nunca se ven.

Observen la ARCANA DIFICULTAD de diagostica la sífilis. ¿Es esto Ciencia?.

Claro, la clínica no vale por sí sola para diagnosticar sífilis -nos dice Smillie- pero entonces, ¿cómo se sabe que los pacientes usado para "validar" el test de Wassermann tenían sífilis en primer lugar?.

Este es exactamente el mismo problema (insoluble) que se presenta con el "VIH/SIDA". Lean, por favor:

Diagnóstico de laboratorio de la infección por VIH-1...


El diagnóstico de la infección por VIH sólo puede establecerse de modo definitivo por métodos de laboratorio, ya que las manifestaciones clínicas, aunque sugerentes, son inespecíficas en cualquier estadio de la enfermedad.

(Página 59)


Y entonces, ¿cómo identificaban a los casos de SIDA entre 1981 y 1985? (año de creación del "test de VIH")

Y entonces, ¿cómo saben que tenían SIDA los pacientes usados para "validar" el "test de VIH". Si al clínica "no vale" TAMPOCO vale para "validar" el test que -supuestamente- valida el diagnóstico clínico. Todo esto es un CÍRCULO HERMENEÚTICO de imposible escapatoria típico de las PSEUDOCIENCIAS.

Existen varias posibilidades de que se obtenga una reacción positiva falsa, mientras que, por otro lado, puede darse el caso de un resultado serológico negativo en una persona que tenga la enfermedad [WTF?]

Un "test" de lo más "fiable". ¿Verdad?.

¡Pues era OBLIGATORIO hacérselo en varias circunstancias!. Lean:

Salvaguardas maritales

Muchos Estados [DE EE.UU] exigen que las personas que proyectan casarse deben presentar un certificado de un médico por el que consta que se les ha practicado recientemente un examen clínico y un análisis de sangre para la sífilis, antes de que les sea concedida la licencia de matrimonio...

...Esta ley tan sabia y beneficiosa ha dado por resultado el descubrimiento de muchos casos de sífilis insospechada. Aproximadamente 1 persona de cada 100 que solicitan la licencia matrimonial...suelen tener un Wassermann positivo

FASCISMO MÉDICO versión USA 1942: Uno tenía que testarse por un test INESPECÍFICO (ver primera referencia de 1923) sí o sí para poder casarse. hace muchos años me escandalicé al leer la frase "La Salud Pública es una rama de la Medicina inherentemente Fascista". Cuanto más sé, más verdad veo en esa frase que me pareció una exageración en su día.

El carácter totalmente autoritario de la Sifilografía se resume en este cartel:

Máscaras antigas militares, público desfilando a paso militar, exhortaciones a alistar a los empleados en la lucha contra el Treponema Pallidum... en las guerras (da igual que sean "contra la sífilis" que "contra las drogas" que "contra el SIDA") las primeras bajas son la Libertad y la Verdad.


...Esta ley tan sabia y beneficiosa ha dado por resultado el descubrimiento de muchos casos de sífilis insospechada. Aproximadamente 1 persona de cada 100 que solicitan la licencia matrimonial...suelen tener un Wassermann positivo

Observen las "infecciones insospechadas" que se "descubrían". Traduzco: PERSONAS SANAS a las cuales se les "revelaba" que estaban "infectadas".

"El Roto" hizo una genial viñeta con este concepto:

Los "tratamientos para sanos" no son algo nuevo. Para colmo en 1942 eran OBLIGATORIOS.

La Sífilis es una enfermedad en que los factores sociales y morales están tras estrechamente entrelazados con sus aspectos médicos y de salubridad pública que es casi imposible discutir esta infección de la misma manera, libre de prejuicios, con que se consideran las otras enfermedades infecciosas, y sin entrometerse en materias que están poco relacionadas con la epidemiología y el control de la infección

Nuevo paralelismo con el TimoSIDA, con respecto al cual se nos dice que "es un tema político y social además de médico".

Que el autor confiese cándidamente su incapacidad para hablar de la sífilis "sin prejuicios" (i.e., JUICIOS PREVIOS) denota que la Sifilografía NO era una disciplina científica.

Antes eran consideradas como contagiosas todas las fases de la enfermedad, pero en la actualidad se sabe que -aún sin tratamiento- la persona infectada no es peligrosa para los demás después de dos años de infección...

Fantástico: Reconoce que se consideraban "contagiosos" a quienes no lo eran. ¿Qué evidencias llevaron a la priemra conclusión errónea y cuales a la "corrección"?: No nos lo dicen.

La frecuencia exacta con que se manifiesta la sífilis no es conocida. Ha existido una tendencia a exagerar su importancia y a sobreestimar la frecuencia de esta enfermedad, a raíz del entusiasta desarrollo de los medios de control. Los datos que han sido recogidos sobre su frecuencia no siempre se han interpretado correctamente.


El mismo Smillie nos previene que todo lo que se ha dicho antes sobre la Sífilis es altamente dudoso y exagerado. ¿Por qué hemos de creer entonces lo que nos diga él ahora?.

La frase sobreestimar la frecuencia de esta enfermedad, a raíz del entusiasta desarrollo de los medios de control es de ALERTA ROJA MAGUFA: ¿Cómo va a sobreestimar uno nada aplicando "medios de control"?. Smillie se refiere al (altamente dudoso) Test Wassermann.



Versión autorizada de la obra "FUNDAMENTAL PRINCIPLES OF BACTERIOLOGY", publicada por la McGraw Hill Book Company, Inc, de Nueva York.

A.J. Salle. Profesor de bacteriología en la Universidad de California (Los Ángeles)

Editorial Gustavo Gili. MCMLXV

Depósito legal B. 13.170-1965

Núm. reg. B. 275-1960

Página 744:

Para el serodiagnóstico de la sífilis se emplean varias pruebas...

Reacción de Wasserman. Este autor propuso una reacción de fijación del complemento en la que el antígeno era un extracto acuoso de feto sifilítico. Más tarde se vio que tal extracto podía sustituirse por un antígeno preparado mediante extracción por alcohol de corazón de buey pulverizado...

La suspensión de lipoides no constituye un antígeno en sentido estricto, pues no es capaz de provocar la formación de cuerpos inmunes cuando se inyecta en un animal. Sin embargo por fijar anticuerpos sifilíticos en el suelo del paciente, suele mencionarse como antígeno.

Una especie de anticuerpo se desarrolla a consecuencia de la infección por Treponema Pallidum, agente productor de la sífilis; como no se sabe si si es un verdadero anticuerpo, generalmente se le da el nombre de reagina. Puede reaccionar con el antígeno lipoideo preparado de corazón de buey y reforzado con colesterina y lecitina. Se ha sugerido que el T. Pallidum lesiona los histocitos del hospedante y separa una fracción lipoide que actúa como hapteno y se combina con la proteína de la bacteria para estimular la producción de anticuerpos (reagina)

Todo esto es un montón de mierda pseudocientífica que NO HAY POR DONDE COGERLA:

* El "antígeno" no es tal antígeno.
* Los "anticuerpos" no se sabe si son tales.
* El "antígeno" T. Pallidum es... extracto de corazón de buey.
* La especificidad (imaginaria) de la reacción está basada en una sugerencia de cómo debe de ser lo que (se supone) lo que que hace el T. Pallidum.​

Página 745

Reacción de Kahn

El antígeno de Kahn se prepara...corazón de buey pulverizado y desecado, y añadiendo colesterina al extracto

Reacción de Kline...

...El antígeno...fracción de hígado de buey...Kline recomienda actualmente un antígeno de cardiolipina reforzado con lecitina

Más de lo mismo mismo: El "antígeno" de el "test del treponema Pallidum" nada tiene que ver con el Treponema Pallidum.

Página 799:

Diagnóstico: En su fase primaria la afección se puede diagnosticar examinando el exudado seroso de un chancro con iluminación sobre campo oscuro (fig. 277). La presencia de espiroquetas es indicio de infección sifilítica. En fases más avanzadas, puede diagnosticarse mediante reacciones serológicas (pag. 744).

Observen que nos dicen que la presencia de espiroquetas es indicio de infección. ¡Aún se reservan la posibilidad de que haya espiroquetas visibles pero NO infección! (las "espiroquetas que no causan sífilis" tratadas en este post).

Observen que las espiroquetas "desaparecen" (son indetectables) en las fases "más avanzadas" de la infección, y hay que recurrir a la "serología" (jugar al QuimiCefa con corazones de buey, como hemos visto).

¿Les parece serio "diagnosticar infecciones" con reacciones no específicas a derivados de corazón de buey (Jugar al QuimiCefa)?.

¿Les parece serio "diagnosticar infecciones" cuando el (supuesto) agente infeccioso no se deja ver por ninguna parte con una técnica tan sencilla y accesible como la microscopía óptica de campo oscuro?.​

Les invito a que mediten sobre la "lógica" de que las "espiroquetas" "desaparezcan" precisamente en las "fases más avanzadas" de la enfermedad. ¿No debería ser al revés?. ¿No debería haber más espiroquetas cuanto más avanzada fuese la enfermedad?.

Una última nota positiva entre tanta miseria intelectual:

Página 800:

El tratamiento consiste en administrar grandes dosis de penicilina drante algún tiempo

Al menos en 1960 ya habían abandonado los bárbaros "tratamientos" con Mercurio y/o Arsénico.

Citas de paper científicos en Inglés

(Si cito en castellano es porque he traducido yo mismo)

Syphilis – Its early history and Treatment until Penicillin and the Debate on its Origins

Up until the early 20th century it was believed that syphilis had been brought from America and the New World to the Old World by Christopher Columbus in 1493. In 1934 a new hypothesis was put forward, that syphilis had previously existed in the Old World before Columbus. I In the 1980′s palaeopathological studies found possible evidence that supported this hypothesis and that syphilis was an old treponeal disease which in the late 15th century had suddenly evolved to become different and more virulent. Some recent studies however have indicated that this is not the case and it still may be a new epidemic venereal disease introduced by Columbus from America.

El mismo "lío" sobre "el origen del VIH".

Mercury had terrible side effects causing neuropathies, kidney failure, and severe mouth ulcers and loss of teeth, and many patients died of mercurial poisoning rather than from the disease itself. Treatment would typically go on for years...

When it was realised by physicians that the toxic effects of mercury often outweighed any benefits it might have had, they looked for alternatives

El Mercurio como AZT de su tiempo.

In 1943 penicillin was introduced as a treatment for syphilis

En 1943 la pesadilla de los "tratamientos" ultra-tóxicos termina.

Before the introduction of penicillin, the heavy-metal cure often caused thousands of deaths each year

El AZT de su época.

Critics of recent palaeopathological studies have pointed out the difficulties in distinguishing syphilis from other diseases that had similar symptoms and left similar bone scars such as leprosy, osteomyelitis, hypertrophic osteoarthropathy, and histiocytosis

Zas en toda la boca a los que "diagnostican sífilis" sobre restos óseos.

Syphilis was a terrible disease because of its propensity to mimic many medical disorders

No tiene clínica propia. Como el SIDA.

From its beginning, syphilis was greatly feared by society – because of the repulsiveness of its symptoms, the pain and disfigurement that was endured, the severe after effects of the mercury treatment, but most of all, because it was transmitted and spread by an inescapable facet of human behaviour, sexual intercourse. The origin of syphilis is still a topic of debate and research

Cambién "Sífilis" por SIDA y es todo igual de cierto.


* Usan Arsenicales MÁS :8: Mercurio.

* Usan los "tests serológicos" como "índice de éxito" del "tratamiento" (exactamente igual que las "cargas virales" del "VIH" se usan para saber si el "tratamiento" tiene "éxito").

* Van bajando las dosis iniciales aconsejadas por Ehrlich (exactamente igual que han ido bajando las dosis iniciales de AZT con las que empezaron en 1986).​

Observation: Use and Abuse of Salvarsan

Recomienda también usar el Salvarsán MÁS los Mercuriales.

Un autor informa de 17 muertes tras inyecciones de Salvarsán.​


Más muertes por Salvarsán.

Discuten sobre si la nefritis en los sifilíticos está causada por el T. Pal o por el Mercurio. ¡He visto debates parecidos sobre la "infección por VIH" discutiendo si tal o cual problema está causado por el "VIH" o por los "antiretrovirales"!.​


Recomendamos la terapia combinada. El tratamiento debe empezar lo antes posible. Cuando haya la sugerencia de una lesión sifilítica primaria e incluso si las espiroquetas no pueden ser encontradas y la reacción serológica sea negativa, el tratamiento debe comenzar sin demora :8:

"Médicos de gatillo fácil": Inyectar un arsenical MÁS Mercurio al paciente por la "sugerencia" de una lesión sifilítica primaria.

¡Esta es la versión 1911 de la actual PEP del "VIH"! (Profilaxis Post Exposición).

"El test serológico es imprescindible para seguir la eficacia del tratamiento"

"Cargas virales del VIH" versión 1911.​


...years ago Fournier (3) maintained that the spontaneous cure of syphilis was possible

Ninguno de los artículos defendiendo el Salvarsán unsa NI GRUPO CONTROL NI SEGUIMIENTO A LARGO PLAZO.

No tenemos ni idea de si el "tratamiento" a largo plazo era beneficioso o perjucidicial para los pacientes. ¿Qué fue de Primum non nocere?.

Lean por favor este artículo de reflexión sobre el uso de Estreptomicina en Tuberculosos:

After six months 28 of the active treatment group had improved markedly and 4 had died, compared with 14 deaths in the control group. However, unexpectedly and devastatingly, after three years 32 of the 55 streptomycin-treated patients had died compared with 35 of the 52 controls – a consequence of natural selection of streptomycin-resistant organisms

Chronic disease: when in doubt, consider accrual into a randomized controlled trial (RCT)

Un "a corto plazo" muy bueno puede terminar en un "a largo plazo" CATASTRÓFICO.

Si uno no estudia los efectos a largo plazo de los "tratamientos", puede cometer errores fatales.

Los "antiretrovirales" NO se estudian a largo plazo, por cierto.

Otra cita de la fuente de arriba:

The sixteenth century syphilis threat led Henry VIII to close bathhouses and brothels; many believed that the ravages of STD (not just on the individual but also on the next generation via congenital syphilis) reflected divine retribution – an attitude that resurfaced in the twentieth century with the emergence of AIDS

Más paralelismos TimoSífilis/TimoSIDA. El TimoSIDA llevó a cerrar las "saunas gays" de San Francisco en los primeros años 1980, como Enrique VIII cerró las saunas por temor a la "Epidemia de sífilis".​


Sugieren "tratamiento" con mercurio durante AÑOS después de "tratamiento" inicial con salvarsán. la "terapia vitalicia" de los "antiretrovirales" ya estaba prefigurándose en el TimoSífilis.​

The Laboratory Diagnosis of Syphilis

¿Qué debemos pensar cuando un laboratorio nos da "negativo" y otro "positivo" en una Wassermann de un mismo paciente?

La primera y más importante prueba de la naturaleza de un caso de sífilis es la presencia de Treponema Pallidum en las lesiones. Desgraciadamente esta es una medida diagnóstica sólo utilizable en casos primarios...

...desgraciadamente otras espiroquetas pueden estar presentes en esas preparaciones y el celo de los microbiólogos ha resultado en una larga lista de espiroquetas con las cuales no ha de ser confundida...

...la Espiroqueta Microdentum es como la Pálida en todo excepto en el movimiento...


...presenta el caso de que el Salvarsán ha causado más muertes de las que hubiese causado la sífilis si se la hubiese dejado a sí misma. Afirma que la neuro recidiva se debe al salvarsán, no a la sífilis

...los casos de sífilis pueden permanecer latentes durante décadas (cita un caso con una latencia de 47 años)

Occasional Lectures Delivered during Session 1913-1914 - October 20, 1913: On Some of the Recent Advances in the Field of Microbiology; with Demonstrations of the Pure Cultures of various Spirochætes, of the Viruses of Rabies and Poliomyelitis, and o

Es imposible distinguir morfológicamente "Treponemas Inocuos" de "Treponemas Sifilíticos".

El TimoSífilis queda al descubierto con esta referencia: Los SANOS TAMBIÉN TIENEN TREPONEMAS.​


El Treponema Pallidum es la "causa probable" de la Sífilis, como el "VIH" ("HTLV-III") fue presentado en 1984 como la "causa probable" del SIDA).​

In vivo culture of treponemes

Es imposible cultivar treponema pallidum.​

Otros a desarrollar:

London Medical Gazette - Google Books

The Medical and Physical Journal - Google Books

The Lancet London: A Journal of British and Foreign Medicine, Surgery ... - Google Books

There was a debate about Syphilis ans its treatment. I stumbled upon these gems...

London Medical Gazette - Google Books

The Medical and Physical Journal - Google Books

(please search "pseudo syphilis"... they also had their "ICL" back them, or their "Syphilis with no treponema pallidum").

The Lancet London: A Journal of British and Foreign Medicine, Surgery ... - Google Books

"The Lancet ...there are many practicioners who deny the existence of this virus...the inevitable consequence of this opinion is that is not neccessary to counteract...by specific medicines"

No, it is not an article published in "Lancet" in 2011 about the Perth Group. It could be, but it is not.

It is an article ("Use of gold in Syphilis") published in... 1829. It is a supreme irony they even used the term "virus" even before discovering viruses.

I got the "syphilis dissident" book by "Dr. vander". It is amazing to read things written about syphilis by this man ("Dr. Vander") that seem to be written about AIDS by David Rasnick.

To my surprise, it does seem to exist an version in English:


I am not sure about the English version being 100% the same as the Spanish version, but at least I checked online that some of the images are identical.

IMHO you should quote the version in English: It is the "official" translation.

I quote you some relevant texts from the Spanish version (correct me if I am wrong: I assume that you understand written Spanish, I think I can remember you speaking some Spanish in some podcasts)

"La sífilis es una enfermedad infecciosa, crónica, que evoluciona por brote por brotes y que está producida por el treponema o espiroqueto pálido, microbio de la sífilis" (pg 350)

This is 100% "TreponemPal/syphilis" official speak.

But later we can read...

"El concepto de medicina natural es distinto...1º Que la sífilis sólo se desarrolla debido a las malas defensas del organismo 2º Que mejoradas estas por la medicina natural se cura perfectamente"

"El doctor Spohr de Frankfort ha curado más de 200 casos de sífilis sin el uso del Salvarsán u otras drogas específicas...otros muchos casos de curaciones de esta especie los cita el doctor Winsch, médico de Halensee, que publicó una obra acerca de estas cuestiones".

(pg 365)

"...es un gran error el considerar que el curso de la sífilis depende sólo y exclusivamente del microbio de la sífilis"

(pg 366).

An explanation about what the Innmune System is follows. And later we can read...

"Por lo pronto hablaremos de las características del microbio de la sífilis...La verdadera causa de la gravedad de la enfermedad por él producida no está precisamente en los microbios de ella...sino en la degeneración física y en las malas defensas del organismo. El microbio de la sífilis no es ni más ni menos terrible que otros microbios patógenos...ninguno de ellos puede vencer a un organismo completamente sano"

pg 367 & 368

Sounds in my ear like the "multifactorial AIDS model" Sonnabed supported in the early 1980s.

In page 370 the author explains how in "semisavage" countries third and fouth stadium syphilis did not occur. Only "civilized" countries suffered those stadiums. And later...

"El curso de la sífilis bajo el tratamiento con drogas. El tratamiento clásico que se daba a base de mercurio fue verdaderamente desastroso, ya que si bien muchos casos con él se conseguía la desaparición de las lesiones de la piel, se producían más tarde las lesiones de cuarto período...El mercurio es un gran veneno y muchos autores coinciden en considerar que agravó el estado de los enfermos". La terapeútica a base de drogas de la sífilis siempre fue deficiente, como lo comprueba el contínuo rebuscar en pos de un tratamiento mejor. Hace poco fue el salvarsán; hoy es el neosalvarsán; mañana será otro producto"

Pg 370

...mercury as the AZT of the 19th century. And this man knew perfectly it was like the AZT.

"no hay duda que los medicamentos empleados actualmente contra la sífilis demuestran su eficacia por lo menos al principio, aunque quede por discutir si es porque atacan a los microbios o porque tales medicamentos provocan una reacción defensiva del organismo y este se halla así en mejores condiciones para combatir a los microbios de la enfermedad"

pg 371

This reminds me of David Rasnick explaining that "ARV"s may work for a while because they are (too) powerful antibiotics!.

...desde la aparición de los primeros síntomas hasta la aparición de los períodos tercero y cuarto pasan una serie de años durante los cuales el sifilítico parece gozar de buena salud...¿Por qué no atacan los microbios durante este tiempo a los órganos?

Pg 372

Sounds like Peter Duesberg voicing his incredulity about the (purported) "HIV latent period".

Cuando todavía era estudiante de Medicina una migo mío de 16 años adquirió la sífilis...le aconsejé que fuese a ver a un médico que ejercía la medicina natural y la homeopatía, para ver si este le trataba sin el perjudicial mercurio que los otros médicos le habían aconsejado, cosa que en aquellos tiempos en los que se conocía menos la medicina natural parecía muy atrevida

Pg 388

...and there is a happy ending: The friend avoids mercury, gets cured, haves healthy children and even tests "Treponem Pal Negative" years later.

Sounds like on of those "I avoided AZT in the late 1980s, and even I seroreverted" histories.

Please read these articles:



These articles read like a precuel of the "HIV/AIDS" histeria: Subtle morfological differences between Treponema Pallidum and spiroqueta dentium (only an experienced technician can differenciate "true" from "false" treponema pallidum) , a flagrant violation of Koch´s postulates in syphilis cases with no detectable treponema palidum (with an admonition to the clinician to "trust" the other tests), greater and greater reliance on laboratory tests for diagnosis and prognosis, an enormous battery of different tests -contradicting each other- depending if you want someone to test "positive" or not...look at this report about the reliability of the Wassermann test:


Oh, and you have also that the salvarsan "proved" to be a good treatmet by "indirect methods" (serology):


...the precuel to "Viral load" "proving" that "ARVs" are "beneficial".

Early 20th century "Duesbergs" (or "Dr. vander", for that matter) that should be treated as "criminals", because -you know?- salvarsan makes the "infected" ("infection" determined by the INDIRECT Wassermann reaction, like the ELISA and WB for "HIV") less "infectious", and therefore there is a "public health" reason to "treat" every "infected" person...

A Discussion on Syphilis, with special reference to (a) its Prevalence and Intensity in the Past and at the Present Day; (b) its Relation to Public Health, including Congenital Syphilis; (c) the Treatment of the Disease

...of course all the notions had been resurrected with the idea that "ARVs reduce viral load and therefore we could eliminate HIV if we treat EVERY infected carrier".

...and -finally- the fact that Syphilis had no specific clinical entity....

doctor Winsch syphilis - Google Search

...Just like 21th century AIDS (1981-84 AIDS was a different matter).

Reading about all this medical lunacy (past in the syphilis, very present in "HIV/AIDS") about "infected blood", "dangerous sex" and medical practicioners taking pleasure describing in an article how the inject mercury oil in their patients using 8 inches platinum needles (yes, I have read about that) I always remember that maybe the wisest AIDS dissident was the first one: The late Casper Schmidt (The Group-Fantasy Origins of AIDS).

Citas de "Inventing the AIDS virus":

En "Inventing the AIDS virus" el profesor de la Universidad de Berkeley y miembro de la Academia de Ciencias Norteamericana Peter Duesberg explica sus sospechas de que la "Sífilis Terciaria" era consecuencia del "tratamiento" para la sífilis previo a la Penicilina (traduzco del inglés)

...Neurosífilis...la bacteria por lo tanto parece no cumplir los Postulados de Koch para esta etapa de la enfermedad.

Una mejor explicación de la Neurosífilis puede estar -irónicamente- en el tratamiento mismo. A lo largo del siglo XIX la terapia de elección era el mercurio, el metal pesado tóxico conocido por causar daños en el sistema nervioso....sólo después de la introducción de la penicilina, que sustituyó al mercurio y al arsénico en el tratamiento de la sífilis en los años 1950, se hizo aparente -con la desaparición de la Neurosífilis- que los doctores había confundido los efectos secundarios del mercurio y del arsénico con la sífilis misma

Página 53​

Peter Duesberg es (como yo) Disidente del SIDA.

Un minuto con Venus, un año con Mercurio. El Mercurio se usaba para "tratar" la Sífilis, como los "antiretrovirales" se usan para tratar la "infección por VIH".

Así terminaban los "tratados" con mercurio:

El gran "éxito" de tratar la sífilis con penicilina fue -en parte- que se les dejó de "tratar" con mercurio o arsénico.

Mis otros hilos sobre el TimoSIDA:













Ver también el excelente hilo-tiro-por-la-culata:



No soy (a Zeus gracias) ni "Sifilógrafo" ni "Experto en VIH". En este hilo simplemente expreso mis opiniones de diletante. Consulten con su doctor y -esencial- LÉANSE CRÍTICAMENTE LA BIBLIOGRAFÍA PERTINENTE antes de tomar cualquier decisión con respecto a la Sífilis o al "VIH/SIDA" (o a cualquier otra enfermedad).

Confiar ciegamente en que "el médico es el que sabe" es exponerse a caer en prácticas altamente dudosas y "tratamientos" altamente arriesgados, como expongo en este hilo.

Si no se informan primero es imposible que puedan dar su consentimiento informado.​
Última edición:


Será en Octubre
14 May 2010
Puntuación de reacción
La propaganda era IDÉNTICA para el TimoSífilis que como es ahora para el TimoSIDA:


Observen que al público nada se le cuenta de las dudas que los "expertos" tenían sobre los "tests de Sífilis":

La sífilis supuestamente mataba a más de el triple de personas que el cáncer. Nos machacan con (altamente dudosas) "campañas anticáncer". ¿Dónde está actualmente la campaña antisifilítica contra esta "terrible epidemia"?. Les recuerdo que la "sífilis silenciosa" oficialmente es transmisible y va destruyendo el organismo. ¿Les han ofrecido alguna vez un test de sífilis desde la SS?.

¿Estaban mintiendo hace 70 años o son unos irresponsables actualmente?.

En Francia imprimieron carteles diciendo que la sífilis causaba más muertos que la I Guerra Mundial y las guerras coloniales.

¿Dónde está nuestra campaña antisifilítica en España 2013 testando a la población frente a tan "terrible enfermedad"?.

"Hágase el test". Como ahora con el de "VIH".

"Consulte con las autoridades sanitarias"

Ahora es curable. ¿Les suena la cantinela con respecto al "VIH" cuya "infección" se ha "cronificado"? (en realidad el "test de VIH" no detecta "infección" alguna).

Observen el logo del WPA:

Works Progress Administration - Wikipedia, the free encyclopedia

El WPA se disolvió en 1943, año de los primeros ensayos de la Penicilina sobre la sífilis, ergo la "curación" que prometía este cártel era aún el bárbaro tratamiento de Arsénico/Mercurio intravenoso.

Tu sangre es mala.

Sífilis en los años 40s - posters - Taringa!

El 70% están condenados si el tratamiento para la sífilis se retrasa 3 años.

The sheer terror of syphilis (as seen in 1930s posters) | Ars Technica

Oficialmente la sífilis se podía manifestar con las enfermedades más dispares...como la "enfermedad por VIH":

Hoy se sabe que la infección por HIV sigue un curso crónico y progresivo de duración variable. Luego del primer contacto con el virus, que puede pasar desapercibido o expresarse clínicamente con signos que no permiten el diagnóstico si no se recurre al laboratorio específico

Manifestaciones clínicas del Sida

Microbiológicamente esto no tiene ningún sentido. Según Peter Duesberg un microbio hace una cosa y sólo una. Es absurdo que una misma infección pueda manifestarse con enfermedades totalmente dispares.

Observen el carácter de "terrible pandemia" y de "asesino silencioso" con que se presentaba a la Sífilis hasta hace 50 años.

Y ahora háganse LA GRAN PREGUNTA: Si las "autoridades sanitarias" decían sobre la sífilis que era tan letal e insidiosa hace medio siglo, ¿por qué ahora en España no hay ninguna campaña contra la Sífilis?.

Utilicen esta pregunta para RELATIVIZAR toda la propaganda sobre el "VIH" del siguiente post.
Última edición:


Será en Octubre
14 May 2010
Puntuación de reacción

Al público tampoco se le cuenta nada sobre el carácter altamente dudoso de los "tests de VIH":

A los pobres "gays" se les sigue ofreciendo el test de Sífilis además del de "VIH":

Todo "por su bien", por supuesto.

En este hilo...

...presenté citas de la Sátira Disidente del TimoSIDA escrita por el Homosexual Disidente Charles Ortleb.

Una cita de Ortleb que me viene a la cabeza viendo estos pósters:

Los Gays asumen que los Científicos y los Doctores sólo tienen los mejores intereses de los gays presentes. De la mano de los gays y de los gobiernos los científicos han estado trabajando para un futuro mejor para la comunidad gay. Y todo debido al desbordante amor y preocupación de nuestra sociedad hacia los gays. ¿Verdad?. Y la gente todavía se pregunta por qué he elegido escribir una sátira sobre la epidemia.

En Hispano América se ofrecen "test de Sífilis" de forma rutinaria a todo el mudno:


UNFPA Uruguay

:: Municipio de Glvez ::

Pregúntense porqué la Sífilis SÍ es (oficialmente) un problema de salud pública en América pero no en España.

Pregúntense cómo sabe el Treponema Pallidum si está en América o en España (no puede saberlo).

Pregúntense si hay algo real detrás de estas campañas o si son un mero constructo social. Si no lo fuesen, ¿dónde está la campaña española para que nos hagamos todos pruebas de sífilis?.

Los Disidentes de la Sífilis

Yo soy Disidente del SIDA (sostengo que no hay prueba alguna de que exista "virus del SIDA") y Disidente de la Sífilis (la versión oficial me parece que hace aguas por todas partes).

Me resulta interesante descubrir que hace 50 o 100 años hubo también Disidentes de la Sífilis.

Les presento a algunos:

Herbert Shelton:

Dr. Vander:

En principio Dr. Vander acepta la causalidad oficial de la sífilis:

"La sífilis es una enfermedad infecciosa, crónica, que evoluciona por brote por brotes y que está producida por el treponema o espiroqueto pálido, microbio de la sífilis"
(pg 350)

Pero Dr. Vander enseguida empieza con matices muy interesantes:

"El concepto de medicina natural es distinto...1º Que la sífilis sólo se desarrolla debido a las malas defensas del organismo 2º Que mejoradas estas por la medicina natural se cura perfectamente"

"El doctor Spohr de Frankfort ha curado más de 200 casos de sífilis sin el uso del Salvarsán u otras drogas específicas...otros muchos casos de curaciones de esta especie los cita el doctor Winsch, médico de Halensee, que publicó una obra acerca de estas cuestiones".

(pg 365)

"...es un gran error el considerar que el curso de la sífilis depende sólo y exclusivamente del microbio de la sífilis"

(pg 366).​

Esto es como el "modelo multifactorial" de SIDA del Dr. Sonnabend:

"Por lo pronto hablaremos de las características del microbio de la sífilis...La verdadera causa de la gravedad de la enfermedad por él producida no está precisamente en los microbios de ella...sino en la degeneración física y en las malas defensas del organismo. El microbio de la sífilis no es ni más ni menos terrible que otros microbios patógenos...ninguno de ellos puede vencer a un organismo completamente sano"

pg 367 & 368​

En la página 370 Dr. Vander nos explica que en países "semisalvajes" no hay sífilis avanzada (porque no hay Medicina Organizada en esos países).

"El curso de la sífilis bajo el tratamiento con drogas. El tratamiento clásico que se daba a base de mercurio fue verdaderamente desastroso, ya que si bien muchos casos con él se conseguía la desaparición de las lesiones de la piel, se producían más tarde las lesiones de cuarto período...El mercurio es un gran veneno y muchos autores coinciden en considerar que agravó el estado de los enfermos". La terapeútica a base de drogas de la sífilis siempre fue deficiente, como lo comprueba el contínuo rebuscar en pos de un tratamiento mejor. Hace poco fue el salvarsán; hoy es el neosalvarsán; mañana será otro producto"

Pg 370​

"no hay duda que los medicamentos empleados actualmente contra la sífilis demuestran su eficacia por lo menos al principio, aunque quede por discutir si es porque atacan a los microbios o porque tales medicamentos provocan una reacción defensiva del organismo y este se halla así en mejores condiciones para combatir a los microbios de la enfermedad"

pg 371​

Suena al disidente del SIDA David Rasnick eplicando que los "antiretrovirales" funcionan (al principio) porque son (demasiado) poderosos antibióticos.

...desde la aparición de los primeros síntomas hasta la aparición de los períodos tercero y cuarto pasan una serie de años durante los cuales el sifilítico parece gozar de buena salud...¿Por qué no atacan los microbios durante este tiempo a los órganos?

Pg 372​

Suna a Peter Duesberg preguntando qué demonios hace el "VIH" en los 5, 10, 15 o 20 años entre la "primoinfección" y el SIDA. Nadie sabe a qué se dedica el "VIH" en esos años.​

Conclusión para Disidentes del SIDA

Me temo que los Disidentes del SIDA pasaremos a la Historia como del mismo modo que han pasado los Disidentes de la Sífilis.

Esto es: Oficialmente NO HABREMOS EXISTIDO o seremos una brevísima nota a pie de página denunciando nuestros "errores".

Escribo esto con tristeza pero creo que es la verdad.

En el mundo Disidente del SIDA veo muchos entusiasmos (injustificados) con el "inminente fin del TimoSIDA". Por ejemplo:

Creo que es contraproducente para la causa Disidente creer o hacer creer que el TimoSIDA se va a "derrumbar".

Es contraproducente porque NO se va a derrumbar, ya que está respaldado por el 100% de los mass mierda y por el 99% (Marco Ruggiero excluído) de las instituciones de enseñanza.

Los insostenibles resultados prácticos del paradigma "VIH/SIDA" no son problema alguno, como no lo fueron ni para el TimoSïfilis ni para los 100 años de "Radioterapia" para el cáncer o los 60 años de "Quimioterapia" para el cáncer.

Si en algún momento la Oficilidad quiere cerrar el TimoSIDA puede hacerlo "sin mojarse" cerrándolo como cerraron en su día el TimoSïfilis: Presentando una "bala mágica" química que "cura" la "infección".

Para el TimoSífilis fue la penicilina, para el TimoSIDA puede ser una "vacuna", una "vacuna terapeútica", un "antiretroviral revolucionario" o lo que les de la gana presentar. Pueden presentarlo y cerrar el chiringuito. nadie les hará preguntas igual que ahora nadie (excepto yo y 4 frikis más) hace preguntas sobre el TimoSífilis y sus "tratamientos" de Mercurio y Arsénico intravenosos.

Nuestro trabajo como disidentes es mantener viva una llamita de pensamiento crítico, pero me temo que es ilusorio pensar que esa llamita algún día va a conseguir quemar el castillo de naipes de la Oficialidad "VIH/SIDA".​
Última edición:

Dr. Bancolchonista ⚕️

Funcivago Matasanos
5 Ago 2013
Puntuación de reacción
Dictadura de la #NuevaNormalidad de COVIDistán
actualmente se realiza PCR (reacción en cadena de la polimerasa) que sirve para cuantificar la carga viral del VIH en sangre, es decir, el número de virus por ml de sangre, midiendo la cantidad de DNA viral. supongo que será un timo también, claro.

no son más que falacias ad verecundiam.


Será en Octubre
14 May 2010
Puntuación de reacción
actualmente se realiza PCR (reacción en cadena de la polimerasa) que sirve para cuantificar la carga viral del VIH en sangre, es decir, el número de virus por ml de sangre, midiendo la cantidad de DNA viral. supongo que será un timo también, claro.

no son más que falacias ad verecundiam.
Otro Testigo de Jehová que no conoce ni los escritos de su propia Secta.

Estúdiese los "algoritmos diagnósticos" oficialistas:

La PCR se reserva para "infecciones dudosas". A casi todo el mundo se le "diagnostica" por "serología".

YO ALUCINO: Foreros defendiendo "ortodoxias" que desconocen :roto2:.

Es como si un musulmán te dijese "Hazte musulmán como yo, tío, sólo hay un Dios, Mahoma, y Alá es su profeta". :XX:

Además está el "pequeño problema" de que el 20% DE LOS "no infectados por el VIH" dan "cargas virales" por PCR :8: :roto2:

CINCO: "Cargas virales" detectadas por PCR en seronegativos sanos.

Empecemos por citar que es la Carga Viral. Cito al gobiernos de los Estados Unidos (es imposible citar una fuente más oficial):

Magnífico. Estupendo. Qué gran avance científico: Los oficialistas del SIDA proclaman que pueden saber "cuánto virus de la inmunodeficiencia humano" hay en la sangre de los "infectados", pudiendo hacer así pronósticos, ajustar el tratamiento y -se dijo en su día- taparnos la boca de una santa vez a nosotros, los fastidiosos disidentes del SIDA.

Pero hay un "pequeño" problema: Las pruebas de "carga viral" detectan "carga viral" en personas que NO tienen VIH :8::8::8:

...we selected 20 healthy volunteers, all of whom yielded negative results for HIV antibodies using different screening tests. Plasma from all of them were analysed by three different currently available HIV viral load tests...

...seleccionamos a 20 voluntarios sanos, todos los cuales dieron resultado negativo en los test de screening de anticuerpos frente al VIH. El plasma de todos ellos se analizó mediante tres test de carga viral diferentes...

In summary, two samples yielded positive results by the bDNA assay, with values of 2020 and 10 620 HIV RNA copies/ml. Another two specimens yielded false-positive results by the NASBA Nuclisens, with values of 150 and 480 HIV RNA copies/ml. Finally, one of the 20 samples was interpreted as positive by the Ultradirect RT-PCR Monitor assay, with a value of 73 HIV RNA copies/ml. Moreover, using the Monitor test with non-B primers, up to four of the 20 samples yielded positive values, ranging from 48 to 253 HIV RNA copies/ml. Results were reproduced in more than half of tested specimens for which plasma volumes were enough for repeat testing.

Resumiendo, dos muestras dieron resultados positivos...otras dos muestras dieron resultados de falso positivo...finalmente, una de las 20 muestras se interpretó como positiva...

Resumiendo: Las pruebas de "carga viral" detectan "copias de VIH" en una cuarta parte de las personas que (según el "test de screening") NO TIENEN VIH.

¿Qué validez tienen unas "pruebas de carga viral" que "detectan" cientos, miles y hasta decenas de miles de "copias de VIH por mililitro de sangre" en personas que NO tienen VIH?. En mi opinión NINGUNA. No valen para nada, excepto para enriquecer a quienes las comercializan y empobrecernos a todos los demás. Más sobre el tema en este sitio Disidente.

SEIS: La literatura oficialista esotérica dice que la PCR no puede usarse como prueba dignóstica. La literatura oficialista exotérica (para médicos) dice que sí puede usarse

Leído en el apartado 5 que los "VIH Negativos" dan (misteriosamente, inexplicablemente) "cargas virales" parece inmediatamente obvio para cualquier persona con un Cociente Intelectual superior a 80 que tales pruebas NO deberían usarse para "diagnosticar la infección por VIH".

Así lo reconoce este artículo Oficialista publicado en Ann Intern Med November 16, 1999 131:794.


El artículo dice BIEN CLARITO que las pruebas de "carga viral" NO son diagnósticas.

La misma Farmaceútica Roche nos advierte de que su PCR no sirve como prueba diagnóstica:

¿Y que hacen los médicos?. ¡Pues emplearlas como pruebas diagnósticas, por supuesto!. ¡Lo contrario de lo que les dicen fabricantes e investigadores!.


* Este manual médico.

Diagnóstico de Laboratorio...Las nuevas técnicas diagnósticas...y en especial la PCR"

* Diagrama de flujo diagnóstico del VIH usando la PCR como una prueba "diagnóstica" en casos indeterminados.

* "Las pruebas de diagnóstico modernas para la infección por HIV, el agente causal del sida (véase el cap. 8), utilizan este tipo de amplificación por PCR de las secuencias del virus"

¡Libros de texto para médicos PASANDO OLÍMPICAMENTE de las recomendaciones de investigadores Oficialistas y del sentido común más elemental!.

* Aquí el NIH recomendando hacer "confirmaciones" con PCR si un "vacunado contra el VIH" da positivo a ELISA+Western Blot: You should also request that, if the ELISA and Western Blot tests are positive, that a PCR (polymerase chain reaction) test be conducted to determine whether the volunteer is actually infected with HIV as a result of his or her own behavior-related exposure to HIV.


Si la PCR es "específica para el VIH", ¿cómo explica usted que un 20% de los "no infectados" de cargas virales? :roto2:
Última edición:


4 Feb 2013
Puntuación de reacción
actualmente se realiza PCR (reacción en cadena de la polimerasa) que sirve para cuantificar la carga viral del VIH en sangre
Falso. Como bien te ha indicado AYN se usa una serie de pruebas que comienzan con ELISA y normalmente acaban con Western Blot. Ambas solo detectan anticuerpos no específicos.

La PCR se reserva como método de diagnóstico solo en recién nacidos. Como llevan los anticuerpos de la madre, estos no "sirven" para el diagnóstico.

Sin embargo, el resultado de usar PCR es, según los propios vendedores de SIDA, bastante desastroso en cuanto a especificidad:

2004: Diagnosis of Perinatal Transmission of HIV-1 Infection by HIV DNA PCR

"In our study we had a very high incidence of false positive HIV DNA PCR (75%) especially in younger infants though there were no patients with a false negative HIV DNA PCR."

Loq ue no sabeos aun y nadie es capaz de responder es: ¿como coño se sabe si un positivo es verdadero?

Para acabar de joderla, la PCR utiliza cebadores que son cadenas cortas de ADN supuestamente de origen viral.

Pues bein, en este documento: Lentivirus Titration using RT qPCR se indican algunos de estos "primers" usados para la detección de eso que llaman "VIH".

Tomemos uno de ellos, por ejemplo la secuencia de ARN "TGTGTGCCCGTCTGTTGTGT" y con ella nos vamos al buscador de genomas BLAST a ver si dicha secuencia aparece en el genoma humano....

En la base de datos "Non-RefSeq RNA" encontramos:

Result: [B]H.sapiens BH30 mRNA[/B]

[B][COLOR="Red"]Identical Match:[/COLOR][/B]
Score         Expect   Identities  Gaps     Strand Frame 
40.1 bits(20) 0.002()  20/20(100%) 0/20(0%) Plus/Plus  


Bingo como una catedral!

La supuesta "secuencia del VIH" que usa la PCR del VIH (prueba de carga viral) no es mas que ARN mensajero humano.

El fraude es monumental.


Será en Octubre
14 May 2010
Puntuación de reacción
Ampliados posts iniciales.

Tag puesto por un pobre ignorante:

se sigue negando a la transfusion

El pobre ignorante barrunto que es Cosbe11:


El pobre cosbe11 ignora (ver hilo para comprobarlo) que las transfusiones son inmunosupresoras per se, aún sin "VIH".

Cosbe11 se niega (ver hilo) a ser el del grupo control que se inyecte sangre de "VIH-". Yo sí acepto inyectarme sangre de "VIH+" en un estudio bien diseñado.

La ignorancia de los Oficialistas de los hechos más elementales de la ortodoxia que pretenden defender es sencillamente increíble: Te dicen que inyectes con sangre de "VIH+" para... no se sabe qué. Pero ellos se niegan a formar parte del grupo control que se inyecta con sangre "VIH-".
Última edición:


29 Oct 2007
Puntuación de reacción
Va pura demagogia. Un tercio de tu argumentacion es que hay otros treponemas, y te dejas que eso es en conejo (cuando le metemos el humano). Hasta el siglo XIX no se usaba practicamente el mercurio para tratarlo, y sin embargo hay claras evidencias de que el "mal frances" llegaba a la fase terciaria neurologica. Aunque se discuta el origen americano de la infeccion, esta bastante claro que fueron los marineros de Cook los que la llevaron a Tahiti, donde no existia antes. Y su llegada a Australia y Nueva Zelanda esta claramente documentada.

Vamos que quieres hacer una reedicion de tus "grandes exitos" con otra enfermedad.
¿Cual es la causa de esta necesidad de notoriedad? El pensamiento transversal, sacar los pies del tiesto, y llevar la contraria a lo asumido por el borregamen esta muy bien, y es lo que en realidad hace avanzar a la ciencia... pero no cuando se convierte en un sistema en si mismo--- Preguntate de donde viene el impulso que te lleva a escribir.


Será en Octubre
14 May 2010
Puntuación de reacción
Va pura demagogia. Un tercio de tu argumentacion es que hay otros treponemas, y te dejas que eso es en conejo (cuando le metemos el humano).
Lea Noguchi 1913:

El bueno de Noguchi encontró en humanos Treponemas indistinguibles del T. Pallidum que NO causaban sífilis.

Esto es como el "VIH" que termina por aparecer en... personas sin "VIH" :8::


Hasta el siglo XIX no se usaba practicamente el mercurio para tratarlo, y sin embargo hay claras evidencias de que el "mal frances" llegaba a la fase terciaria neurologica. Aunque se discuta el origen americano de la infeccion, esta bastante claro que fueron los marineros de Cook los que la llevaron a Tahiti, donde no existia antes. Y su llegada a Australia y Nueva Zelanda esta claramente documentada
Aporte referencias externas de sus 3 afirmaciones.

Yo me molesto an referenciar todo lo que digo. ¿Puede usted hacer lo mismo?.
Última edición:


4 Feb 2013
Puntuación de reacción
¿Cual es la causa de esta necesidad de notoriedad?
Esto es un foro y según tú cualquiera que habra un hilo para discutir un tema está "buscando notoriedas". ¿Tu eres tonto del culo, no?

---------- Post added 09-ago-2013 at 12:02 ----------

Va pura demagogia. Un tercio de tu argumentacion es que hay otros treponemas
No te enteras. No hace falta ningún trepanoma para diagnosticar sífilis.

Te has pasado las referencias de AYN por el forro de los cojoncillos.

hay claras evidencias de que el "mal frances" llegaba a la fase terciaria neurologica
¿En ausencia de tratamiento? NO.

Eso llamado "fase terciaria" se corresponde con síntomas de envenenamieto por metales pesados.

fueron los marineros de Cook los que la llevaron a Tahiti, donde no existia antes. Y su llegada a Australia y Nueva Zelanda esta claramente documentada.
Pues documéntanosla a ver por donde hace aguas las cosa.


29 Oct 2007
Puntuación de reacción
En la base de datos "Non-RefSeq RNA" encontramos:

Result: [B]H.sapiens BH30 mRNA[/B]

[B][COLOR="Red"]Identical Match:[/COLOR][/B]
Score         Expect   Identities  Gaps     Strand Frame 
40.1 bits(20) 0.002()  20/20(100%) 0/20(0%) Plus/Plus  


Bingo como una catedral!

La supuesta "secuencia del VIH" que usa la PCR del VIH (prueba de carga viral) no es mas que ARN mensajero humano.

El fraude es monumental.
Si claro bingo. nos vamos a Pubmed
H.sapiens BH30 mRNA - Nucleotide - NCBI

Y tenemos:
TITLE Cloning of a long HIV-1 readthrough transcript and detection of an
increased level of early growth response protein-1 (Egr-1) mRNA in
chronically infected U937 cells

¿De que vas? ESO no es una secuencia humana.

Nos vamos a BLAST
BLAST: Basic Local Alignment Search Tool

Y metiendo esas 20 bases. Sacamos que ciertamente hay secuencias similares. Alguna en la que coinciden los 19 primeros aminoacidos. Logico, el DNA humano esta tan lleno de impactos de DNA virico, como la luna de crateres. Pero si sabes hacer PCR, (cosa que ni se ni me importa) la ultima base es esencial para que la DNA polimerasa enganche bien.
En otras son 15, lo cual es poco si subimos la temperatura de annealing. Y finalmente habria que rechazar las secuencias no codificantes puesto que estamos hablando de RNA.

Llevas meses dando vueltas con este bodrio.

---------- Post added 09-ago-2013 at 12:14 ----------

No te enteras. No hace falta ningún trepanoma para diagnosticar sífilis.

Te has pasado las referencias de AYN por el forro de los cojoncillos.

¿En ausencia de tratamiento? NO.

Eso llamado "fase terciaria" se corresponde con síntomas de envenenamieto por metales pesados.

Pues documéntanosla a ver por donde hace aguas las cosa.
Uy! Te has cagado? Has quitado lo del tonto del culo.

Y los de la teoria magufa sois vosotros. Ya se que os pasis el metodo cientifico por el arco de triunfo, pero este dice que si quereis tirara abajo la hipotesis dominante, sois vosotros los que teneis que aportar informacion.


4 Feb 2013
Puntuación de reacción
Me hace gracia la etiqueta "son chancros sanos".

Esta gente debe pensar que son formaciones extraterrestres. Se niegan a ver lo evidente, que es el propio organismo el que organiza el chancro, que "aprendió" a responder de este modo dunrate la evolución y que por ello esta respuesta orgánica tine un fin y un objetivo favorable a la supervivencia. Pista: del chancro SALEN cosas.

---------- Post added 09-ago-2013 at 12:18 ----------

¿De que vas? ESO no es una secuencia humana.
Claro que no, solo es mRNA (partícula mensajera) de una célula humana, no te jode?

cellular gene expression

Cloning of a long HIV-1 readthrough transcript an... [Arch Virol. 1999] - PubMed - NCBI


To identify the pathways involved in HIV-1 modification of cellular gene expression, chronically infected U937 cells were screened by mRNA differential display.

Se está llamando "virus" a particulas claramente endógenas y tu te quedas mirando con cara de pan.
Última edición:


29 Oct 2007
Puntuación de reacción
Claro que no, solo es mRNA (partícula mensajera) de una célula humana, no te jode?

cellular gene expression

Cloning of a long HIV-1 readthrough transcript an... [Arch Virol. 1999] - PubMed - NCBI


To identify the pathways involved in HIV-1 modification of cellular gene expression, chronically infected U937 cells were screened by mRNA differential display.

Se está llamando "virus" a particulas claramente endógenas y tu te quedas mirando con cara de pan.

Venga va, a ver si demuestras todavia mayor ignorancia. Tu mismo estas mostrando que una celula humana con VIH es capaz de sintetizar RNA virico que no existe en una celula humana no infectada.

Tu argumento va en contra de lo que quieres decir y no te das ni cuenta.

Dejo de perder el tiempo contigo y tus multinicks.


4 Feb 2013
Puntuación de reacción
Tu mismo estas mostrando que una celula humana con VIH es capaz de sintetizar RNA virico que no existe en una celula no infectada.
Ah si? En qué parte del estudio se esconde el cultivo de control?

Un cultivo de control de células "no infectadas" y sometido a los mismos estímulos químicos es necesario para poder demostrar que el mismo mRNA no existe en una celula no infectada.

Que no hay cultivo de control? Que se lo han pasado por el forro de los cojones?

Entonces, granuloso, lo que afirmas es pseudociencia.

Logico, el DNA humano esta tan lleno de impactos de DNA virico, como la luna de crateres..
Y tu cara de espinillas.... El DNA humano no es un virus ni sirve para diagnosticar una infección vírica, por muchos "impactos" especulativos que se te antojen.

Tu debes crees que la nula especificidad de la PCR para el VIH es obra del demonio, o algo parecido.
Última edición:


29 Oct 2007
Puntuación de reacción
Ah si? En qué parte del estudio se esconde el cultivo de control?

Un cultivo de control de células "no infectadas" y sometido a los mismos estímulos químicos es necesario para poder demostrar que el mismo mRNA no existe en una celula no infectada.

Que no hay cultivo de control? Que se lo han pasado por el forro de los cojones?

Entonces, granuloso, lo que afirmas es pseudociencia.
No se en que planeta vives. El genoma humano hace ya 10 años que se secuencio, y el transcriptoma mas de lo mismo.

Oye... ¿tu obsesion con los granos... tiene algo que ver con tu adolescencia?
¿se metian mucho contigo? ¿acabaste al menos la secundaria?
  Es duro pedir pero más duro es robar
Por favor, permite que se muestren anuncios en burbuja.info y contribuirás a su supervivencia.